CK935227

Overview
NameCK935227
Unique NameCK935227
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length132
Libraries
Library NameType
Developing fruit 24 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004564_C11 Developing fruit 24 DAFB Citrus sinensis cDNA clone T24DAB0001_IIIF_C11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK935227 ID=CK935227|Name=CK935227|organism=Citrus sinensis|type=EST|length=132bp
GGGATCTCATTATTATCTTCTCTTTTATGTGTTGTGTTTTGTCTGATTAT
TTTAATGCTTTGAAAGGGATATTGAGTAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top