CK935405

Overview
NameCK935405
Unique NameCK935405
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length413
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1812 contig Csv1_Contig1812:1..413. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit 24 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004562_A06 Developing fruit 24 DAFB Citrus sinensis cDNA clone T24DAB0001_IF_A06 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK935405 ID=CK935405|Name=CK935405|organism=Citrus sinensis|type=EST|length=413bp
AGATAGCCCATATGATGATCCATTCTTGAGGTGCTGTTGTTGCCCTTGCT
TTATGGTCTCATCTATTTTCACTGGAATCCGTAGGTGCATATTTGTGGCT
TGTTATCCTCTCCTTCGTTGCTTTGGATTAGATGATTCCAGTCACCACCA
TCATCATCACCACGGCCATTTCCATTGAACCCATTTACGTTTTTCCATTC
AATTCCTGTCGTTTCACTATTCAATGCTCTCTCTCCCTCTCCCATAATTG
AAAGATTTGCATATGATTTGTGAATTCGGTTTACAATTTTTCTTGTATGC
AATATTGTTTGTTACATAATCGGCACGCGCAAGATTCTTTACTAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCAAAAAAAAAAAAA
AAAAAAAAAAAAA
back to top