CK935418

Overview
NameCK935418
Unique NameCK935418
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length572
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2354 contig Csv1_Contig2354:84..655. BLAST: Citrus Unigene V1 Contigs to TAIR9
Libraries
Library NameType
Developing fruit 24 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004555_H12 Developing fruit 24 DAFB Citrus sinensis cDNA clone T24DAB0004_IVF_H12 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK935418 ID=CK935418|Name=CK935418|organism=Citrus sinensis|type=EST|length=572bp
GGGAGGGCTATAGCTCAGTTAGGTAGAGCACCTCGTTTACACGTGCGCCA
ATGTTTTTCAGAGGAGTCCATCATGCAATCAAAAGAATTGATCTTTTTGA
GAAATTAATGTCTGACTCCGTGGCTTGTAGGGAACAAAACAAGAGAACAA
TAGCCTGACAAATGGATCGGTCCGATTCGGGTGCCCTTTTAGGAACCAAA
TAGAATCCATCATCGATTTGAGAGATTGATAAGGTAAATACCTAGTCTAT
TCAATGCTAGGCATAATGAGTATAAGGACCTCAAAAATTCTCTTTTCGTT
CTATGAACCTTAAGGCGTATGAAGTTTCATATGTGATTCTTTAATCAGGA
TGATAGAGACTCCATTTCGTTTAGGTTGATCTAGGCCATAAGCAGACCTA
CGTCAAGATAACCCTTCTTTGAAACACTTTGGGAGTGCTCCTATATCCGA
ATCCAAATAATGAATTAGAGCACATGGAGCCATTTCCTTAGTTGTCTGTC
AAGAAAAAAATATGGTAGACTAACTGATATTTCTATCAGTTAATGAAAGA
GCCCAATGCAAAAAAAAAAAAA
back to top