CK935421

Overview
NameCK935421
Unique NameCK935421
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length776
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Developing fruit 24 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004562_A03 Developing fruit 24 DAFB Citrus sinensis cDNA clone T24DAB0001_IF_A03 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK935421 ID=CK935421|Name=CK935421|organism=Citrus sinensis|type=EST|length=776bp
GGGAAGCCTCAACAAGACAACTCTCCCTCCGCTCCCTCTTTCTTACTCCT
CTCCTACTTCTCTCCATCAAATCGAATTACAAAGGAAACATGGTGGTGAG
AGTCATTGAATCAAAGAACAGAGCAGAAACTTTAAAGTTTTTGTGCAGTT
ACGGCGGCAAGATTCTTCCTCGTTCAATGGACGGCCAGCTTAGTTACGTA
GGCGGCCTCACCAGAGTCCTCTCCGTTGAGCGTTCTATATCCTTTGCAGA
GCTGATGGTGAAACTAGGAGAGTTCTGTGGATATTCCGTGACGTTGAGGT
GTCAGTTACCAAACGGAGATTTGGAAACCCTAATCTCGATCAAGTCCGAC
GACGATTTAGCTAATCTCATTGAAGAATACGATCGCGCGGCGCCTTCTTC
GAAGATCAGAGCAATTTTATCGCCTCCAGCATCACTGAAGAAAGTATCGC
CTCCTGCGAGCGTGGATCTTCCTGCAACCAAGCAGCCGGTCGCGGCCGTT
AATCATCGCTCCGCTTCTCGCCCTTTTTCTCCGCCGTCGATTGGATATCG
TTGTCAGCCTTCTTCGCCACCGTACGGTTGTCCTGTATCCGGCAAAGTCT
GCTACTATCCCTGCCACCTTCAAGGAACCCCTAGGTCCTTGTATTATGGT
CCTCACAATAACTACTGGCATTGAGACTTAAAGCCCTAAATTTTACAGAG
CGCTTATAGTCGTAATGATGAACAAGGCAATACAGTAGATAATTTTTTTA
AAAAAAAAAAAAAAAAAAAAAAAAAA
back to top