CK935426

Overview
NameCK935426
Unique NameCK935426
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length431
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3439 contig Csv1_Contig3439:409..839. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit 24 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004555_H04 Developing fruit 24 DAFB Citrus sinensis cDNA clone T24DAB0004_IVF_H04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK935426 ID=CK935426|Name=CK935426|organism=Citrus sinensis|type=EST|length=431bp
GGGGGCTCAAGTACTTATTTTTTAATATAGTGCACTCGAAGCTAGCAAAT
ATCTTTTCTGACTTGAAGAATATGAAAACTCTTCCTGGCGCAGGTATGAG
CGATCCGTCAGAAGGTTACTTACTCCCCCCTTCCAGTATTGCTGATGATG
ATGTTGGGAATGACAATCTTGATCTTATTGTTATTCCTCAATATGGGAGA
AATCCTGATTATTATGGGTAAGTGTCTGCAATCTGGATGATGATATATAT
AATTAAATAAAAAGATGGGTACAGTTATTATCTATCAATTATAAGAGTGT
CAATTTAGTTCAGTTCACTTACAAAAATCTCTTATACAAGAGATTATCTT
TGTTTGCGTTCATGTACTTTGTCTTCTTTAATTAATAAATAAAACTATTG
TGTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top