CK935427

Overview
NameCK935427
Unique NameCK935427
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length890
Alignments
Feature NameTypeLocationAnalysis
CK935427_ssr475 microsatellite CK935427_ssr475:475..484.
Csv1_Contig12550 contig Csv1_Contig12550:11..901. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Developing fruit 24 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004555_H05 Developing fruit 24 DAFB Citrus sinensis cDNA clone T24DAB0004_IVF_H05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK935427 ID=CK935427|Name=CK935427|organism=Citrus sinensis|type=EST|length=890bp
TTTTTTTNNNTTAATTTTCAGATTCGTGTGCCCTTCGGAATACCTGGACC
GGAGGCGGACAGGAGGTTGGCCGATATATTTTACAAGTTTTGATGGCACC
GAACGGTTTGTTCACCGTTCTGGGATTTGATGTGAAGGCTAAGCTCATTG
TTCATCTTTAAGGTGTAAAGCCTGAATGTGTGATAAATAATTTTGAGCCG
CTAATTGATCATGCGGGTAGGCTTGTGCCGCATAATTGGGAGTGAATTGC
GGGATTGTGGAGGGTTTTTATAATGGATGTAAGAGATGCGTCAGGACAGA
GAAGCCTGAAATTAAGATGGCTGAGACCTGATTATTCTTTGTCATCCGGC
CTTTGCCATGGCAGGTGCGCTTGCATGGCAGGTCACCAAAATCTTAATAA
AAATATTTATTTTGTGGTCCTGAGGGGAGATCGCACGGGAGTTGCCCGGG
TTCTCCTCTCCTGAGTGTTGTGCTTGTGTGTGTGGGTATCATTCTCCGTT
TCTGTTGCCTTTTGCTAGAGTTGACACTATCGATCCATCGGATTTGCATT
CTAAATCAGCCTCAGCTCAAAATCACCGTGCCTATAAACCAATCCACTTG
CAGTTCGCGAAAGGTTTGGTATCATGCCCTGCTGACTTTTAAAACAGAAC
ATATTTGCAAAATACTGCGCTTTAATTAATATACAAGACCTATCCATGCA
GTCAGTTCAATTTTAACATTCCAACGTTGATGTATCCTATTTGAACTATC
ATTTTTTTGGCTTTAAAATTTGCCTCTAGAGATAAGCAAGTATTCTATTG
TTGGCTTTAAAATTTGCCTTTAGAGATAGGTTTCCTTTTTATGTTTATTT
TTTGCCTTACCCCTATTTGGTAACTTGCCAGTAGCAATGA
back to top