EY735565

Overview
NameEY735565
Unique NameEY735565
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length876
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY735565_ssr12 microsatellite EY735565_ssr12:12..23. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig13144 contig Csv1_Contig13144:34..909. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange fruit, development stadium (6 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-705-001-B12-CT.F Sweet orange fruit, development stadium (6 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY735565 ID=EY735565|Name=EY735565|organism=Citrus sinensis|type=EST|length=876bp
CCACGCGTCCGAAATAAATAAATAAGATTAAAAATAAATAAAAATGATGA
GTTCACTGTCGCTGCACAATAATTCTTCGATATCAAAGGCGGCAGCTTCG
AGTTCGATTTCGACATCGACGAAATCGCTCTCGTTCGATGATATCTCCAA
ATATTTCTCTCTCCCTCTCTCCGACGCCGCCAATCATCTCGGTGTCTGCG
TGAGCGTTCTCAAGAAAATCTGCCGCGACAATGGCCTTGATCGCTGGCCT
TATCGCAAGTTTCTATCTGGAAAAAGCATTGAGGATATTAAAAAGTATGC
GGCTAGAGAAAAAAGCAAAGAACTGGCTGAGCTCTCCAAGATTGCTAGGA
AAAGTGGATTTCAACCCCTAAACAATGAAACATCCAAATTACATGGAGTT
GCCTCCCCTCCTAATTTGCAGCAACAAGGAAGCAAAAGCAGTCCAGTCGG
GCAGCCACACGTCTTGCTTAATGCAAACTTGACAAAAGGAATCATGGCCC
TGGATGAATTTAAACACGGATTCCCATCAGATGGCTTATCAACTGCTTCA
TATAAATGGTGGGGTAGCAGAAGTTCTGATGGCAATGATGGCATCCATAA
AGATGAAAGTGAAATAGATGAAGAAGACAAACAAGCTGAAGCAAAAGCAG
ATAAAGAATCTGCTACACAAGCAACAGGCAATGAAAAATCTGGCAATGGG
GAAACAGAGAGCAACGTTGACCCTCANGGGTCAGGTCTTTTGACAGCTGT
CAGAANACGAACTGTAGAGGAAGGGACAGAAGCACTTAAGCTTGGTGTTT
ATAAGAAGTACTGTGTAAAGCACCTAGACAGGAAAGAGAGAGTGCTGGCT
CCCAGAATATTCAAATCTTCATTGCC
back to top