EY735550

Overview
NameEY735550
Unique NameEY735550
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length770
Alignments
Feature NameTypeLocationAnalysis
EY735550_ssr400 microsatellite EY735550_ssr400:400..411.
Csv1_Contig8049 contig Csv1_Contig8049:115..884. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange fruit, development stadium (6 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-705-001-A07-CT.F Sweet orange fruit, development stadium (6 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY735550 ID=EY735550|Name=EY735550|organism=Citrus sinensis|type=EST|length=770bp
CCACGCGTCCGGGGGAAGGAATTAAGAGATGCTCCTGCCCCTCTTGGTTA
CCACTGAGATGGGATGAATTTGAGATTGTTTGTCAGATTTGTGGTTGAGG
TACTTCTACATGGATTGGTCTGAGATAATGAGGTTTCTGTATATGCTGAG
AATAGTACACTAGGAGTATGAAATGTCAAGCTAAATGAAAAAGGGGTATA
GAGTTTTCTGTATATGCTGAGAATAGTACACTAGGAGTATGAAGTGTCAA
GCTAAATGAAAAAGGGGTATAGACTAAATAAACACATGTGACTTTCTAAA
CCCAATTTGGTTGAATTTTATAAGCTTTGAGATTAGACTGCTTGTGTTTC
TGTATGATAAGCAAGTAGCATGTTCCCAGTAGCTCCTCAGTACATCACCA
TTTATTTATTTTACTTGTGCTAGCATTTTCTATTAGACATTCATATGAAG
GAGACAGGGAGATGGAGACATCTTGAGTGGAAGGGAATCGTTGCTTCATA
GATGATATTGCTGCAAGTTTCCCCAAAAGCAGCATGCAAAAGGTCAGGAT
TTCTTCTTGAACTCCCAATATGTTCCCTGATATGAGTGAAGTGTTGTTGG
TGAGAACCCCCAATTGTGCTTTATCCATGTAGTCATAAAAGAAATCGAAG
TGTGGTGCTGGTANCTCAAAAGGTTGTAAGTTAAGATCTCTCATANTCAT
ATGACGTACCAATTCTGTATAATGATGAGGCTGGCTGCTCTATAATTTTA
CTGCAAAAAAAAAAAAAAAA
back to top