EY735549

Overview
NameEY735549
Unique NameEY735549
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length477
Libraries
Library NameType
Sweet orange fruit, development stadium (6 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-705-001-A06-CT.F Sweet orange fruit, development stadium (6 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY735549 ID=EY735549|Name=EY735549|organism=Citrus sinensis|type=EST|length=477bp
CACGCGTCCGGGCTGTCTAAATTTCATAGGATGTAAGGCACATTGTGTGA
AGCTAGTATGTTACTGAGAGAATAGCTCGAAGACACGGCTATTAACTTTA
GTTTTTATTGAGCAGTTTCTAGATGCTTGACATAAGCTTGTAATTACTGT
AACTGAGAAGAAGTAAGCCTTTCTACATCTTCGTGCGCTTGCGATTTTAC
TCTTTGAGTACTCTGAATTTTACAATTTTCAATTCCTGGTTGTAGGCTGA
GTTGGCGAAGCATTCGAGAGTTTATTAAAATACCTATGAGGAAGCAGTTT
GTGTTGTCAGATGGGCGGTCTCTTTTGCTGGTCGGAAGGAAGAGAAATTT
TCAAACATTTGCTTTGATCGGATGATTGTAATGAATTAATGACTTTACAA
AAGAAGGAATGACATAATGAATGTGAATATTTATTTTGTCTANNAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top