EY735545

Overview
NameEY735545
Unique NameEY735545
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length830
Alignments
Feature NameTypeLocationAnalysis
EY735545_ssr579 microsatellite EY735545_ssr579:579..590.
EY735545_ssr166 microsatellite EY735545_ssr166:166..177.
Libraries
Library NameType
Sweet orange fruit, development stadium (6 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-705-001-A02-CT.F Sweet orange fruit, development stadium (6 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY735545 ID=EY735545|Name=EY735545|organism=Citrus sinensis|type=EST|length=830bp
CACGCGTCCGGTATCATAGATAGGTAGTTGTTTCGATAATGCCACATTGC
ATTTATTTTGAAAATAAATTAAATATTCTATATTGTGAACTTTATTTATT
TGGTGCATTAAATGAGATCAATAATAATACAACAATAAAAAGAAAAATCT
CCCTTGTTGTCTTAAAATAATAATAATTTTTTTTTTTTAAAAGCACTTGG
AAAAAAATACCTAAAATTTTGGAAAAACGGCAATGTCTTTTAACTTATTT
GTCAAAGAAAAATACAGTACGTTATAAAAAAATTAATTAGTAAGTTGAAC
ATGCGGGAGTAAAAAAAAATCGTTAATTTTAAATTTGGGAGGTTAATGAA
GATTCTCATTCGCATATGAAAAACTAAACAAATGGCTGGTGGGTTATAAA
GAATAATAAGTCTCTGTGTTTTGCTTTTAAATAAGGGGATATCGTCAGGA
ATGTCTTTATCTGAGGGGCCTTCTGGTCCTGGTAGATCCCTCTGAACGTA
CCAAAATTTTGCAGGGTTCGATTTCAGTCGGTATTTGAATTTTTAATTCA
TTAGTGTAGTGGACACTTGCCTGGTATGGAGAGAGAGAGAGCCTCGGACC
ACGTTCATTAATTTTAATGTCCCTGGATAGATTAGACGCTACAGACTATC
TGATCCAAAATAAAAAAAGATGTGGGCTCTTGACCCGGACGGAAGCCCTC
CGCCGCACCGCCTTGAACCCGTGTGTTCGCGGGAATTTAACACGTGTTCC
AATATCCGGTCTGCGCGGTCCTCCTGTGCAGATGATTCACAGCAGGAACG
CCGCGAGTACGGGGGGCTCGTGGACCCCCA
back to top