EY756570

Overview
NameEY756570
Unique NameEY756570
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length722
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3527 contig Csv1_Contig3527:107..833. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-010-B03-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756570 ID=EY756570|Name=EY756570|organism=Citrus sinensis|type=EST|length=722bp
TCCGTCGACCCACGCGTCCGGCTGTCACTCCACATAATCAGCAGGTGCAA
AATTTACATTTACATTCTAGTGTTAAGGAGGTTCAGGGTAGAGAATTCAA
GAAGGAAGGATCTTTGACTGGTTCGAACTCTAAGTCAGTTAACGAAGAAG
ACAGTATTGACAAAAGTTCTGATGTTGACTCTCAGAGTAGGCGGCAATCT
TTGGATAAGGAGGATAACTGGCCGGAGGTAGCCTTTGAGCTTAAACCAAG
TGAGAATTCTGCCTTCTCTGTGATAAGAACTAGTACAGATAAGCATATGA
AAGGATTTGTGCCGTATAAAAAACGTATAGTGGAAAGGGACAATCAATTG
TCAGCAGTAGGCAGTGGAAGAGATCAAAGGGAATGGTAAAGATGCCCATA
TTTCTAGGAAAGCCGATGATTTGTAGAGCTGACGATCTTTTAGTAGATAG
TTCTCTTGTTCAAGGACTTGAGGAACTGATTTGGGTGGCACAGATAATGT
TTTGACTGAAGCGGTCTTCTGCTGCTAGATAGGACGGTAAATGAAGTAAT
GCGTATTAGTTCCACAGCTGTGCAAATTCTTATCTAGTCACCGAGTTTTT
TTATCTGCAACTGTTCAAATTAGTAGGTGTCCGGTTTGTATGTTTCAATT
TTAAATTGCCGTTTCTCTCTGTTGAAATATAGCTTTTTACATTCCTTTTT
AAAAAAAAAAAAAAAAAAAAAA
back to top