EY756569

Overview
NameEY756569
Unique NameEY756569
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length416
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13336 contig Csv1_Contig13336:1..416. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-010-B02-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756569 ID=EY756569|Name=EY756569|organism=Citrus sinensis|type=EST|length=416bp
AACCAAAGTTTTCACTGGGAAGAAGTAGAGCAACAGTTAGTTTCCTGGAT
TGTTATGTAGTCTTGAGATGACAAGGATCTCATAGAGACCATTGATTGAT
CAAAGATTTAGTTAATTGGGTGATTCTGATGCCTAGCACTCTGATGATGC
CGAAAAAGGTCAGCTTATTCATACTGTGGTTTTTGGTGAAGATGCAGTAA
GGCATCCAGCCAAATAGGTTTATAGTGTATACGCTGTAATAGAAGAACAA
TGGAAGTGAACTAATACATTGTTCTTTATATTTTTCTACTTGGGGTTGAG
CTATCACAACTCACAAGTCATGGAATTCCATGTAATTATAAACTCTATTC
CATTTTGACTAGTAGTTAAAGCCATCTCGCTGATGAGAGCTTGATTGTTA
AAAAAAAAAAAAAAAG
back to top