EY756566

Overview
NameEY756566
Unique NameEY756566
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length344
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig362 contig Csv1_Contig362:219..562. BLAST: Citrus Unigene V1 Contigs to Populus V2 proteins
Properties
Property NameValue
Genbank descriptionCS13-C1-001-010-A11-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756566 ID=EY756566|Name=EY756566|organism=Citrus sinensis|type=EST|length=344bp
CCACGCGTCCGATTTGATTGTGTCCAAGAAACCTTTTTGGAGAAGTCTGA
AGAAAAATAAAATTGACGTTGACGATCCGGTGAAGCTTTTTGATGTCTGC
TTTTGGGTTGTGGATGAGAAGAACATGGACATATTTGTTCTGAAATAATG
TAGTTTCATTTTCTACTTCATGTCCTAAGGCCTTTTGGCATTTAACTTTT
GAGAATATTTGATTTGCTCAGACCCGCAAGTTTGTGTTAATTTTCATTGA
AATTTCTTCGTGAGCATTCTCGCGCCCTTTCTCCTTAAAAAGGAAGTGAT
AAAATTCTTTTTCTTTCATTGAAAAAAAAAAAAAAAAAAAAAAA
back to top