EY756565

Overview
NameEY756565
Unique NameEY756565
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length421
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12881 contig Csv1_Contig12881:1230..1650. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-010-A10-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756565 ID=EY756565|Name=EY756565|organism=Citrus sinensis|type=EST|length=421bp
CCACGCGTCCGCTCGAAGTAGCAAAGATCTTTTCTGACTTGAAGAATATG
AAAACTCTTCCTGGCGCAGGTACTAGCGCCACGTCAGAAGGTTACTTACT
CCCCCCTTCCAGTATTGCTGATGATGATGTTGGGAATGACAATCTTGATC
TTATTGTTATTCCTCAATATGGGAGAAATCCTGATTATTATGGGTAAGTG
TCTACAATCTGGATGATGATATATATAATTAAATAAAAAGATGGGTACAG
TTATTACCTATCAATTATAAGAGTGTCAATTTAGTTCAGTTCACTTACAA
AAATCTCTTATAAAAGAGATTATCTTTGTTTGCGTTCATGTACTTTGTCT
TCTTTAATTAATAAATAAAACTATTGTGTATCATTGTGTTGATTAAAAAA
AAAAAAAAAAAAAAAAAAAAA
back to top