EY756564

Overview
NameEY756564
Unique NameEY756564
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length893
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12553 contig Csv1_Contig12553:131..1029. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of EY756564 vs. ExPASy Swiss-Prot
Match: PRP39_XENLA (Pre-mRNA-processing factor 39 OS=Xenopus laevis GN=prpf39 PE=2 SV=1)

HSP 1 Score: 84.7297 bits (208), Expect = 7.614e-16
Identity = 77/257 (29.96%), Postives = 130/257 (50.58%), Query Frame = 3
Query:   12 ACANYPEYWIRYVLCMEASGSMDLAHNALARATHVFVKRLPEIHLFAARFKEQNGDIDGARAAYQLVHTETSPGLLEAIIKHANMERRLGNLEDAFSLYEQAIAIEKGKEHSQTLPMLYA-QYSRFLHLVSRNAEKARQILVDSL----DHVQLSKPLLEALIHFESIQSSPKQIDFLEQLVEKFLMSNSDSPSTANAAEREELSCVFLEFLGLFG-DAQLIKKAEDRHARLFLPHRSTSELRKRHAEDFLASERAK 764
            ACA Y E+WI+Y   ME + S++   +   RA HV + + P +HL  A F+EQ G+++ AR   + + T    GL    ++  N+ERR GN+++A  L E+  A+ K K  S++    YA + +R L  V  N  KAR++L +++    ++ +L   LLE   + +  Q+    +   ++ ++          S  + A R + S   +EFL  FG D   +    + H +L L H+   ++ KR AE+ L    AK
Sbjct:  353 ACACYEEFWIKYAKYME-NHSVEGVRHVYNRACHVHLAKKPMVHLLWAAFEEQQGNLEEARRILKNIETAIE-GLAMVRLRRVNLERRHGNVKEAEHLLEE--AMNKTKTSSES--SFYAIKLARHLFKVQANVVKARKVLSNAIQKDKENTKLYLNLLEMEYNCDIKQNEENILAAFDKAIK----------SPMSIAMRVKFSQRKVEFLEDFGSDVNKLLDTYNEHQKL-LKHQ---DIVKRKAENGLEQPEAK 589          
BLAST of EY756564 vs. ExPASy Swiss-Prot
Match: PRP39_DANRE (Pre-mRNA-processing factor 39 OS=Danio rerio GN=prpf39 PE=2 SV=2)

HSP 1 Score: 84.3445 bits (207), Expect = 9.945e-16
Identity = 71/267 (26.59%), Postives = 130/267 (48.69%), Query Frame = 3
Query:   12 ACANYPEYWIRYVLCMEASGSMDLAHNALARATHVFVKRLPEIHLFAARFKEQNGDIDGARAAYQLVHTETSPGLLEAIIKHANMERRLGNLEDAFSLYEQAIAIEKGKEHSQTLPMLYAQYSRFLHLVSRNAEKARQILVDSLDHVQLSKPLLEALIHFESIQSSPKQIDFLEQLVEKFLMSNSDSPSTANAAEREELSCVFLEFLGLFG-DAQLIKKAEDRHARLFLPHRSTSELRKRHAEDFLASERAKMGQSYSGAPSPGQSL 809
            ACA Y E+WI+Y   +E S S +   +   +A  V + + P +HL  A F+EQ G ID AR+  + V     PGL    ++  ++ERR GN+E+A +L + AI    G+  S++      + +R L  V ++  +A+++L+++++  + +  L   L+  E      +    +    ++ L S+    S    ++R+      ++FL  FG D   +  A ++H RL     +  E  KR AE+      AK  ++   + + GQ +
Sbjct:  457 ACALYEEFWIKYAKYLE-SYSTEAVRHIYKKACTVHLPKKPNVHLLWAAFEEQQGSIDEARSILKAVEVSV-PGLAMVRLRRVSLERRHGNMEEAEALLQDAIT--NGRNSSES-SFYSVKLARQLVKVQKSIGRAKKVLLEAVEKDETNPKLYLNLLELEYSGDVQQNEAEIIACFDRALSSSMALESRITFSQRK------VDFLEDFGSDINTLMAAYEQHQRLL----AEQESFKRKAENGSEEPDAKRQRTDDQSVASGQMM 708          
BLAST of EY756564 vs. ExPASy Swiss-Prot
Match: PRP39_HUMAN (Pre-mRNA-processing factor 39 OS=Homo sapiens GN=PRPF39 PE=1 SV=3)

HSP 1 Score: 80.4925 bits (197), Expect = 1.436e-14
Identity = 76/293 (25.94%), Postives = 130/293 (44.37%), Query Frame = 3
Query:   12 ACANYPEYWIRYVLCMEASGSMDLAHNALARATHVFVKRLPEIHLFAARFKEQNGDIDGARAAYQLVHTETSPGLLEAIIKHANMERRLGNLEDAFSLYEQAIAIEKGKEHSQTLPMLYA-QYSRFLHLVSRNAEKARQILVDSLDHVQLSKPLLEALIHFESIQSSPKQIDFLEQLVEKFLMSNSDSPSTANAAEREELSCVFLEFLGLFG-DAQLIKKAEDRHARLFLPHRSTS----------ELRKRHAEDFLASERAKM-GQSYSGAPSPGQSLMGAYPSSQNPWAAG 851
            +CA Y E+WI+Y   ME + S++   +  +RA  + + + P +H+  A F+EQ G+I+ AR   +    E   GL    ++  ++ERR GNLE+A  L + AI   K    S      YA + +R L  + +N  K+R++L+++++  + +  L   L+  E      +  + +    +K +  +         ++R+      +EFL  FG D   +  A D H  L     S            E +K H ED  +S    + G   +       S    Y + QNPW  G
Sbjct:  382 SCALYEEFWIKYAKYME-NHSIEGVRHVFSRACTIHLPKKPMVHMLWAAFEEQQGNINEARNILK-TFEECVLGLAMVRLRRVSLERRHGNLEEAEHLLQDAIKNAKSNNESS----FYAVKLARHLFKIQKNLPKSRKVLLEAIERDKENTKLYLNLLEMEYSGDLKQNEENILNCFDKAVHGSLPIKMRITFSQRK------VEFLEDFGSDVNKLLNAYDEHQTLLKEQDSLKRKAENGSEEPEEKKAHTEDTTSSSTQMIDGDLQANQAVYNYSAWYQY-NYQNPWNYG 661          
BLAST of EY756564 vs. ExPASy Swiss-Prot
Match: PRP39_MOUSE (Pre-mRNA-processing factor 39 OS=Mus musculus GN=Prpf39 PE=2 SV=3)

HSP 1 Score: 79.7221 bits (195), Expect = 2.449e-14
Identity = 74/286 (25.87%), Postives = 130/286 (45.45%), Query Frame = 3
Query:   12 ACANYPEYWIRYVLCMEASGSMDLAHNALARATHVFVKRLPEIHLFAARFKEQNGDIDGARAAYQLVHTETSPGLLEAIIKHANMERRLGNLEDAFSLYEQAIAIEKGKEHSQTLPMLYA-QYSRFLHLVSRNAEKARQILVDSL----DHVQLSKPLLEALIHFESIQSSPKQIDFLEQLVEKFLMSNSDSPSTANAAE-REELSCVFLEFLGLFGDAQLIKKAEDRHARLFLPHRSTSELRKRHAEDFLASERAKMGQSYSGAPSPGQSLMGAYPSSQNPWAAG 851
            +CA Y E+WI+Y   ME + S++   +  +RA  V + + P  H+  A F+EQ G+I+ AR   +    E   GL    ++  ++ERR GN+E+A  L + AI   K    S      YA + +R L  + +N  K+R++L++++    ++ +L   LLE     +  Q+    ++  ++ +   L        +    E  E+      + L  + + Q + K +D   R         E +K H ED L+S +   G   +   +   S    Y + QNPW  G
Sbjct:  380 SCALYEEFWIKYAKYME-NHSIEGVRHVFSRACTVHLPKKPMAHMLWAAFEEQQGNINEARIILRTFE-ECVLGLAMVRLRRVSLERRHGNMEEAEHLLQDAIKNAKSNNESS----FYAIKLARHLFKIQKNLPKSRKVLLEAIEKDKENTKLYLNLLEMEYSCDLKQNEENILNCFDKAIHGSLPIKMRITFSQRKVEFLEDFGSDVNKLLNAYDEHQTLLKEQDTLKRKAENGSEEPEEKKAHTED-LSSAQIIDGDLQANQAAYNYSAWYQY-NYQNPWNYG 657          
The following BLAST results are available for this feature:
BLAST of EY756564 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 4
Match NameE-valueIdentityDescription
PRP39_XENLA7.614e-1629.96Pre-mRNA-processing factor 39 OS=Xenopus laevis GN... [more]
PRP39_DANRE9.945e-1626.59Pre-mRNA-processing factor 39 OS=Danio rerio GN=pr... [more]
PRP39_HUMAN1.436e-1425.94Pre-mRNA-processing factor 39 OS=Homo sapiens GN=P... [more]
PRP39_MOUSE2.449e-1425.87Pre-mRNA-processing factor 39 OS=Mus musculus GN=P... [more]
back to top
Properties
Property NameValue
Genbank descriptionCS13-C1-001-010-A09-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756564 ID=EY756564|Name=EY756564|organism=Citrus sinensis|type=EST|length=893bp
CCACGCGTCCGGCATGTGCCAACTATCCTGAGTACTGGATACGATATGTT
TTGTGCATGGAAGCCAGTGGAAGTATGGATCTTGCGCATAATGCACTTGC
TCGTGCAACTCATGTCTTTGTCAAGAGGCTGCCAGAGATTCATCTTTTTG
CTGCCCGATTCAAAGAGCAGAATGGGGATATAGATGGCGCTCGAGCTGCT
TATCAACTTGTACATACAGAAACTTCTCCTGGTCTTCTTGAAGCAATTAT
TAAGCATGCCAACATGGAACGACGGCTGGGGAATCTTGAAGATGCCTTTT
CGTTATATGAACAGGCCATTGCTATTGAAAAAGGGAAAGAGCATTCACAA
ACATTACCAATGTTGTATGCTCAGTACTCTAGATTTTTGCACCTGGTTTC
TAGAAATGCAGAGAAAGCCCGGCAAATTCTTGTTGACTCGCTTGACCATG
TTCAGCTGTCAAAACCACTTCTAGAGGCCTTGATTCATTTCGAGTCTATT
CAGTCTTCACCAAAGCAAATTGATTTTCTGGAGCAATTGGTTGAGAAGTT
CCTTATGTCAAATTCAGATAGCCCCAGCACTGCAAATGCAGCTGAGAGGG
AAGAGCTGTCTTGCGTTTTTCTAGAGTTTTTGGGTCTCTTTGGGGATGCA
CAGTTGATCAAGAAGGCTGAAGATAGGCATGCCAGACTTTTCTTACCTCA
TAGAAGCACATCAGAACTAAGGAAACGTCATGCAGAGGATTTTTTAGCCT
CAGAGAGGGCTAAGATGGGCCAATCTTATTCTGGCGCTCCTTCACCAGGC
CAATCATTGATGGGTGCTTATCCAAGTTCACAAAACCCTTGGGCAGCTGG
CTATGGCGTTCAGCACAAACTTGGCACCGGCGACAAGGCACAG
back to top