EY756563

Overview
NameEY756563
Unique NameEY756563
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length255
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3221 contig Csv1_Contig3221:831..1086. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-010-A08-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756563 ID=EY756563|Name=EY756563|organism=Citrus sinensis|type=EST|length=255bp
CCACGCGTCCGGGACCCATTTCCTCTGAGAATAAAAAAATGCTTGAGAGG
ATGAATGAAGAAGGGTTAGATAGGTTAAACGCACTTGGTGTTTTTGATAA
TTTCTCTTATGTTGTGTTTAAAGACCTTATTATGGTATTCTGTTACTAAT
GTTATGTTTTGAGATTTTGTCTCTCTTAAACTTGTGATCATCATTTTGTT
AGTAGAGATTATGTGATTTTCTTTTAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAA
back to top