EY756560

Overview
NameEY756560
Unique NameEY756560
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length873
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13445 contig Csv1_Contig13445:1..873. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS13-C1-001-010-A04-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756560 ID=EY756560|Name=EY756560|organism=Citrus sinensis|type=EST|length=873bp
CCACGCGTCCGACCGAATGTTGGCTCTGAGCTACCTGAGCAATGGTCCCG
AGGAATTTGTTGAGAAAACAGTCGACCTCCCTCATGCACTGTGATTTAAG
GCCTTGCCTGTTTTTACTGGTTTTTAGTTCACAGAGATGGACCACAGGAT
CAAAAATAACATCATCTTTGTTATATGTACAATGNATGACAGNNNGATTC
ATAATTTTGATCCTGTGGTCCATCTCTGGGAGCTAGATTATGGATCAAAC
TGCCATGCATTGTACATACTGCAAAGATGATGTTATTTTTGCGCGTGACC
AAATTTACTGGGAGAATGGTATCAGCGCTACTTGCCACATGGATGGGGGT
GGGTGGGCAGCAAAGGAAGAAGTATAGTGTACACCAAAAATCACTTGGCC
GCCTGTTCGAGGGGCACCTACCTGTCGGAGTCGCGCCCTGCTTGACCAAG
CTAAGTTGGGGTGAGAACTAATTCGTTTAGCCGGCCGGCGTTTTATCTCC
TTAGGCGCCGGTAATATCCTGTTGCCACATAGCTTTATTACCTTGGGTCT
AAGGGACGCCCACCAGAGGGGCAAACACACGCGACCATGTGAGTGATGCT
TGTAAAGACCCACAAAACTGGGAGGCCAAGGGACCCCTCGGAGATGCGTC
ATTCGGACCGAAGGGCCACTGAACTCGGGTCCGCGAACGTCACATGAGCG
AGGCCTCCACAGCCGGCCAGCGAATAGTTATAGTGCCCTTACCCTCAAAA
CACGATTTTTTGTATGATCACAATTGTCGGGTAACGGATGAACACAATTT
GGGCGTCCGGGACGTGTACCTANACTTATTAAACGTCTGTCTGTACGTCT
GTATTCACAACCCTGAGATGAGG
back to top