EY756558

Overview
NameEY756558
Unique NameEY756558
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length607
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
EY756558_ssr438 microsatellite EY756558_ssr438:438..449.
Csv1_Contig11492 contig Csv1_Contig11492:25..631. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS13-C1-001-010-A02-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756558 ID=EY756558|Name=EY756558|organism=Citrus sinensis|type=EST|length=607bp
CCACGCGTCCGCAAGCAAGAAAAACAAAAATGGGTTCCAAATTGTTCCTT
CTTTTAGGCCTTTTAATGGCCATTGCTCTTCTTATCTCTTCCGAGGTAGC
AGCCAGAGACCTGGCCGAGACTTCCATTGATCACAACGAAAAGGCTGATA
AGGCCACAGAGACACATGAAATTGAGGACGGTCGCGGCGGATACGGCGGC
GGTGGTGGGGGCTATGGCGGTGGTGGGGGCTATGGCGGTGGTGGGGGCCA
TGGCGGGGGCCATGGTGGTGGCCATGGCGGTGGCCATGGCGGTGGCCACT
GCCCCTACGGTTGCTGTGGACGTGGTTATTATGGAAGAGGCTGCAGGTGC
TGCACTTACGCTGGTGAGGCTGTTGATACTGAGCCTGAAACCGAGCCTCA
AAACTGAAGCTCCATAATAAATTTGTATCTGTATCTCAATAAATAAATAA
TCTTGCTTACATTTATGCGATGTAAGCTTCATTCTGTTTTTCCTTTTTTC
TTTGTTTTGTAAGTGCAATGTAAGCTGCTTGTTCACAAAAATAATACTTC
TTTTATATAAAAGAAGTATTTATGAAATAATGAGTACATTTTTAGAANNN
ANNAAAT
back to top