EY756551

Overview
NameEY756551
Unique NameEY756551
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length402
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY756551_ssr347 microsatellite EY756551_ssr347:347..356. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig1444 contig Csv1_Contig1444:266..667. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-009-H07-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756551 ID=EY756551|Name=EY756551|organism=Citrus sinensis|type=EST|length=402bp
CCACGCGTCCGCCTTTGATGGCCTTACAGGCAACGGCTTCAAGTTCAGGC
TTCTTTGAAGGAAAAGGCAGTGACAGGACTGACAGCAGCTGCTTTGACAG
CTTCAATGGTGATTCCTGAGGTGGCCGAGGCAGCTGGCTCTGGTCTTTCC
CCTTCTCTCAAGAACTTCTTGCTCAGCATAGTTGCTGGTGGAGTCGTCCT
AGCCGCTATCGTTGGAGCTGTCATTGGTGTCGCCAACTTTGATCCTGTTA
AGCGTACCTAAAGGAGGTTCTCACTATTGTGTGAATTTTCTTTGCCCCTT
TTATTGCATTGTTGTTGCTTCATTGTCTAGCTCTTGTTAATTAGCAATAT
ATATATAAATGCAAGCCTTTGTCTGAAAAAAAAAAAAAAAAAAAAAAAAA
AA
back to top