EY756550

Overview
NameEY756550
Unique NameEY756550
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length527
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10296 contig Csv1_Contig10296:500..1026. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-009-H06-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756550 ID=EY756550|Name=EY756550|organism=Citrus sinensis|type=EST|length=527bp
CCACGCGTCCGCGATACTTCCCTCATTGCTCAGAATTGGTTGATCGCTTT
TTGCATTGGCCCTATGCTTCCACCCCAGAAATGGACGAGGAGAAACTTAA
AGTATACGTGCAGGAGGCACTCCGCAAGGACGTGGCTTATCACCGTCGTT
CAGGGCTGCCATCATCCTGGTCGGCATTTTACAAGTACATGGCTGAGAGC
AATCAGTTGGCATTTTACAAGTACGTGGCTGAGAGCAATCGTTCAGGAAT
GCCGACGTCCTCGGCATCGAGCAATTAAGCATCACCTTTCCCTAAAAGTT
ATATTTGACACCTGGAAAACTAAAGGAGTTGAGTGAGCTCTGCTCGATTG
GTATTTGTAGTTTCTTTTTTTTTTTCCTCAAGTGATGTGGCATGTATCAA
TTAGTTTGTAAAGTTATTGTATTGTCTCAAGTCCGGTAAGATGCGCGAAC
GTATAGCATGGATCACAAACTCATTTCATAGAATATTTTTGTGTATAATT
ATATAATTTATAGGCTTAGCTTAAAAA
back to top