EY756522

Overview
NameEY756522
Unique NameEY756522
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length287
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig96 contig Csv1_Contig96:551..837. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-009-E12-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756522 ID=EY756522|Name=EY756522|organism=Citrus sinensis|type=EST|length=287bp
CCACGCGTCCGAAGGGACCTTGTCCAGACATCTGGGGATCAGATTGATTG
CAATTTCTACCAACTGCAGCAGTTAACCGAATTTGGTTGTGTACTAGGCT
ATGAGCTATGTAATTTCATTACAGTTTAAATTTGAATGTCATGGTTTTGT
TCTTGAACTCAATTGATCTGCAATCTGATTCAGGGTACTGTAAGGGGTTG
TATTTCATGTAATTTTTGTATTTTCTCTATTGTTTCTTCTCAGTAAAAGC
AATAGTTTGCGACAAAAAAAAAAAAAAAAAAAAAAAA
back to top