EY756517

Overview
NameEY756517
Unique NameEY756517
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length239
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
EY756517_ssr189 microsatellite EY756517_ssr189:189..203.
Properties
Property NameValue
Genbank descriptionCS13-C1-001-009-E06-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756517 ID=EY756517|Name=EY756517|organism=Citrus sinensis|type=EST|length=239bp
TTCCGTCGACCCACGCGTCCGGAAAAGAACTCTCTCCTCTTGTGTAACTA
GGGTTGGGGCATGGGTGAGGGAATATTGAAGACCAATTACATCCAGATGA
AGAAAACTAAGAAGTTTATATTCATTTGCAACAATTTTCTTTCAAAAAAG
AGATATTAAATTTTGTAATTATTTTTGTATTGGTCATCAATAATAATAAT
AATTGTTTTTAAATTAATTAAAAAAAAAAAAAAAAAAAA
back to top