EY756509

Overview
NameEY756509
Unique NameEY756509
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length743
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-009-D10-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756509 ID=EY756509|Name=EY756509|organism=Citrus sinensis|type=EST|length=743bp
CCACGCGTCCGAGAAAAAATCTGCTAAGGCTGCCCCATCTTCTTTATCAT
TGAAAATTGATGAAAGGGCCGAGAAAAGGAGAGAGGAGAATAAAGAAGTG
GATATCAAAAAGGTAAGGCAGAACTCAAGTTCCAAAGCCAGATCAGCGCC
AAGTTTATATCCTGGACAAAAGATATTGAAAGGCTGTTTAAATAAGGAGG
GTTTAAAGAATGAGATACATCGGTGAACTGGGTCTCTTTCATTGGAAATC
ACCAAGTATCCACCATCAGCAAACACAAATAAGAATACAATTTCAATGGT
CTGGTGAAGGAACACAAGATGTGACGATGTTATCTACTTTGGAGGGTAAT
TAAATCTAATGGACAGCAGATAAAATATGAAGTCGTTGCTTCTGTGTAAG
GGCCCATGGCCGTGTGTCGTGATATTGTTACTTAGCGGGAGAAACCAACC
ACTCATTGATGAGTCACAGGCTGCGGATATGAAACATCCCATTAATGGTC
ATCTTCTTTTCTTGTGGGCCTTGTTCATTATTTGTTGAAATAGAGAAGAG
AGTGAAGCTGTGATATCTCTCATCGATGAACTGCAGCACCCATATATAAT
ATGCAGCCTCAATAAAAAAAAAGGGGATGTGGGAGTTCTGTTAGAAGGTT
TAAGCATGGACTTCTTGTGCCTGTTGCACCCAAATATGAACGTTGACGCT
GTTTTTTTTTTTTTAGGGGGTTATGCTAGTCATCCGTCTATTA
back to top