EY756507

Overview
NameEY756507
Unique NameEY756507
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length524
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13328 contig Csv1_Contig13328:1..524. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS13-C1-001-009-D08-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756507 ID=EY756507|Name=EY756507|organism=Citrus sinensis|type=EST|length=524bp
CCACGCGTCCGTTTTTAAGAAACCCTTACTATCGCTACGGTTGATGAAGA
GGAAAGGTTGAGTTAGCGGACATTGCAATGGGGTCGGGACTAGAGTCGAA
ACTCAAATTGCACATTTTGCAGCAAGTCAGGAGGGCTACAGCCACGTGAC
CTTGAATTTGATTCCCCAACCTCATTGTCACTGTTCAAAGCGAAGCGATC
TTTTTGGTATAAATGGTCTTCTATTTCCCTCCCTGCAGGGGTTAAAACTG
TTAGAAAAACACTAGATCAGTTCGGAAGGACCTATGTAGTCAGGCAAAGG
TAGACAGCAAGCCACTGTGGTTTGACTTCACTACTTTGGTGATAATGGTT
CAAGGTGATGTTGGTGGCTTTCCGGAATTTAATATCAATGTTTTTTTTAT
GGATTAATTGTTTTTCTAGTGATAGGTTGATGATTGGATATTGTAAAGGA
TTTATGAGATATGATAGACGATGTATTTTGATGATGCTATTTATTGGAAG
TTTCAAGTGATTGGAAAAAAAANN
back to top