EY756504

Overview
NameEY756504
Unique NameEY756504
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length634
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY756504_ssr598 microsatellite EY756504_ssr598:598..607. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig13332 contig Csv1_Contig13332:1..634. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-009-D04-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756504 ID=EY756504|Name=EY756504|organism=Citrus sinensis|type=EST|length=634bp
CCACGCGTCCGTGAATTTATAAGCATGTGGGATTTGACCCCATTTTGACT
CAAAAATTCATCAAACAGATTCAGCTGTTTTCTCATTACAAGTCAAACAA
ATAGGCTAAAAATGAAGAACAATTTTGGTTTTTTTTTCAATAGAAGCCAG
TTTCAATGGCTATGCCACTGAGCTCAGCAACCCAGAACAGGCTTATTCAG
CCTAGCTCTGAATCCTTCCTGAAGCCGTTGCCTGTAAGGCCATCAAAGGC
AGCTAGATTCTTGGGAAAGCCAAAGTCAAGAGCCAGGCTTCAAGTTCAGG
CTTCTTTGAAGGAAAAGGCAGTGACAGGACTGACAGCAGCTGCTTTGACA
GCTTCAATGGTGATTCCTGAGGTGGCCGAGGCAGCTGGCTCTGGTCTTTC
CCCTTCTCTCAAGAACTTCTTGCTCAGCATAGTTGCTGGTGGAGTCGTCC
TAGCCGCTATCGTTGGAGCTGTCATTGGTGTCGCCAACTTTGATCCTGTT
AAGCGTACCTAAAGGAGGTTCTCACTATTGTGTGAATTTTCTTTGCCCCT
TTTATTGCATTGTTGTTGCTTCATTGTCTAGCTCTTGTTAATTAGCAATA
TATATATAAATGCAAGCCTTTGTCTGAANANNNA
back to top