EY756500

Overview
NameEY756500
Unique NameEY756500
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length488
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12328 contig Csv1_Contig12328:636..1124. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-009-C11-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756500 ID=EY756500|Name=EY756500|organism=Citrus sinensis|type=EST|length=488bp
CCACGCGTCCGGATATTCCAGTTGGGAAAACACATGAAATTCAACAGTCT
AGTGTTTTTGGGATGCCGGCTGGGTTTAACATTCCAGCTCGAATTCATGG
CCAAGATCATCACCAGCACAGTAACAGGCCCTCCTCTTCTTCTCCCAATA
ATTCTCACCGCTGATAAAATTTACTTACCAAGGTATAATCATTAGTATTT
TGCAGGTGTTTAATTTCTTTCTTCAAAGCGTATGCGTTGAGATTTGAAAG
TAATATATCCATGGACGTCACCCAAATTTCAAATAAAAGTTATTATTTTT
TGGGAGAAAATTTTTGTTTTTATGTTCTTCTTCTAGCTGTTTCAAGCCCT
GTAGTAGTAATCATACTTATCCGAATGTAGCAAGAATTCCTCAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGG
back to top