EY756469

Overview
NameEY756469
Unique NameEY756469
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length281
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1032 contig Csv1_Contig1032:550..829. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-008-H12-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756469 ID=EY756469|Name=EY756469|organism=Citrus sinensis|type=EST|length=281bp
CCACGCGTCCGCCATGAGGGTGCTCTTGTCACTTTTCATAACCTTTTGTT
GATGTAATTGCGTTCTTATGTTGATACATGGTTGGTCTCATGGTTGAGTT
TGTGACTCTTTTCAAATTGTTTAGGTGGACATGCTGTAAAAATTAGTGAG
GGGAAGAAGTTCATACCCTGTCTTGGTTTCCCTAATGTCTGTCTGCATTC
TCTGTAGTTGTGGGTGTACTTGTCTAGTAATTGCCTAACCGTGTTGTTTC
TCNNAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top