EY756467

Overview
NameEY756467
Unique NameEY756467
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length890
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-008-H10-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756467 ID=EY756467|Name=EY756467|organism=Citrus sinensis|type=EST|length=890bp
CCACGCGTCCGAATGTTTTTTTCCATTTTTTTTTTTTTTTTTAAAAAAAA
AAAAATTAAATTCCGTCCTAATTCTTATGAACAAATGCACATGCCCAAAT
GTTCCTAGAACTGCAACAGTTGTTAAAAAAAGAATAGATGCATGCTGTGC
TTATTCTTAAGGGCATTACCGAAAGTGATCTCATATTATACCTTTCCTAG
AACTACCATGATGAACTCTCAATCTTTTATTCTTGAACAACAACAAGTTG
TGATGGTAGATGTCACTGCAAATCAATAACCCGGTGGAAAAATTGTTCCT
CCGACTCCTCAAAAACCGATGATATATCCTCCTACTGTAGGGGGATGGGG
AGATGTTCCGTTAAGTATGGCAACCCCGACCATGATGTGCAAAATTTCTT
ATGGCTTCGAGGGTCTATAGGTATGGATACTGGAATCATATTGATGCACA
TGGCAACTCATACGGCATGCAGCATAATCACGGGGCAGTGCCGCCACCGA
GAAAGATCAAGTTTAATAACATATCGTAGGAAATGGATCGGCTATTTTTG
TTTAATGCTAGTAAGAGAAGCCTGTGTCCAAGTGTATATCCTTTCGGATG
AAAAGACCGTTGAGATACGCAAGGTAACCTGTGAAGAACTACATACTCTT
AAGCGTTTCTGTTGAGATGAAAATGACGCCTCTCCTTACTTTCTTTCCTT
AATGGTGGGGGGCTTGAATTGTCAATGTGTAACGCAACTGGTGAAGCGAT
TTTTATGCGAGCGGGGGGGGGTGTACACGTAGGTGGGGCATTTCCAATGC
CAAGAATAATTGCGCGATCTTTTTAACGTTTTGCGCTATTTTTTGCGCCA
CCCCCCCGGTGTTCCGAAAAAGCTTTAAAGGGGGGTCTCT
back to top