EY756258

Overview
NameEY756258
Unique NameEY756258
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length394
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9157 contig Csv1_Contig9157:91..484. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS13-C1-001-006-D09-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756258 ID=EY756258|Name=EY756258|organism=Citrus sinensis|type=EST|length=394bp
CCACGCGTCCGTCTCGGATGAGGTCTGTCCCGATTAAATCCAACCAGCAG
GAACATAAGAAAAGTGCATTAAAAGATAAGGGAGCAAGTTCAATCTTGAA
TTTCTTCAAGAGCGGCGACCTCTCTTGCTCTTCGGGGAACCATGATACTG
AACATGCTGAAACCTTATTGCCCTTGGGTGATTGCTTGTCAGAGTCCAAT
AAGAAGCAAGTTAATATACCAAAAGAGAGACTAGATAATTCGACAGGTGA
TTGCTTGTCTGAGTCTAATCAGAATCAAGTTAATATACCAAAAGAGAGAC
TAGCAGAGGCTGCAACCACAAGCACATCCACTGACAGGTGTGGTTCAGAT
CAGATTCAACAAAGAAGTGAATCATGGAAACTCAGGATTGAGGA
back to top