EY756248

Overview
NameEY756248
Unique NameEY756248
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length489
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-006-C11-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756248 ID=EY756248|Name=EY756248|organism=Citrus sinensis|type=EST|length=489bp
CCACGCGTCCGACTTCATAAGTGTTTGTGATGACCAAACCGAGAAAGGCG
CATGAGATAGGCTGCAACAAGTGAGCCATGAGTACACTATGTAGAACAGC
AAGCTTTCATACACTATTCAGGATGGAGCAACAAATACTTGCTGCTGGTG
GGCCAGTTCCTTAGGAATATATGACATTGATGTTATCCCCCTATTGGCAA
ACATAAAAAATAGCCATCGTTTATCATTGCAATTACTTTATAAACCAGAT
TTTGCAGATCTGATTTCCAGACTACTTTGATTTGATGTCAAAGGATCAAA
TTAGATGTATGTTTAAATACTACAAAGAGAGATTGCCAATGGAAGCACAG
ATTACAATCTCTTCTTCTGCTATACAGCACACAATAACATCCTTCTATTC
ATTGCCCTGAATCTTCTGATCAATCTTATACTGAAACTGATGTTGAACCT
TCCCGTGTCCTATTGAGGTCAAGTTTAAGGGAAAGCAAG
back to top