EY756244

Overview
NameEY756244
Unique NameEY756244
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length249
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-006-C07-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756244 ID=EY756244|Name=EY756244|organism=Citrus sinensis|type=EST|length=249bp
CCACGCGTCCGGGGAACTAAAAGATACTGTGGATGCAATTGAATCATAGT
AAGCTTGTTGCTCTGTTTCTTATACTCTCTTGCCAGTGGAAAAAGTACGT
CAGTGCACAATACTTCAGCAAACTTTCTTACTTTTCATTGAACGCTTATG
AATTGGATGCAAATGTTATATAAATTAAGTTTCAAGTGCATTAATTAATT
TTCATGTTTGGATCNNNNNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top