EY756190

Overview
NameEY756190
Unique NameEY756190
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length619
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2790 contig Csv1_Contig2790:66..688. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS13-C1-001-005-F11-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756190 ID=EY756190|Name=EY756190|organism=Citrus sinensis|type=EST|length=619bp
TTCTCTGCACAGAAAAAAAAAATGGGTTCCAAATTGTTCCTTCTTTTAGG
CCTTTTAATGGTCATTGCTCTTCTTATCTCTTCCGAGGTAGCAGCCAGAG
ACCTGGCCGAGACTTCCATTGATCACAACGAAAAGGCTGATAAGGCCACA
GAGACACATGAAATTGAGGACGGCCGTGGAGGTTATAACCGCGGTGGCCG
TGGAGGTTATAACGGCGGTGGCCGTGGTGGCTATGGAGGTGGTGGGGGCT
ATGGCGGTGGTGGGGGCTATGGCGGTGGTGGGGGCCATGGCGGTGGCCAC
TGCCGCTACGGTTGCTGTGGACATGGTTATCATGGAGGCTGCAGGTGCTG
CACTTACGCTGGTGAGGCTGTTGATACGGAGCCTGAAACCGAGCCTCAAA
ACTGAAGCTCCATAATAAATTTGTATCTGTATCTCAATAAATAATCTTGC
TTACATTTATGCGATGTAAGCTTCATTCTGATTTTCCTTTTTTCTTTGTT
TTGTAAGTGCAATGTAAGCTGCTTGTTCACAAAAAAAATACTTCTTTTAT
ATAAAAGAAGTATTTATGAATAAATGAGTACATTTTTAGAGCTTTAAAAA
AAAAAAAAAAAAAAAAAAA
back to top