EY756183

Overview
NameEY756183
Unique NameEY756183
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length610
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11941 contig Csv1_Contig11941:93..702. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionCS13-C1-001-005-F03-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756183 ID=EY756183|Name=EY756183|organism=Citrus sinensis|type=EST|length=610bp
CCACGCGTCCGGGTTCTAGCTGCAAGTGCGGCGGCGGCTGCGGCGGTAGC
TCCATGTACCCTGACTTGAGATCCTTTGAGAGCACCACCGTAGCCACCGA
GACCCTCGTCCTCGGTGTTGCTCCTGTCAAGATGCACTCTGAGGGGTCCG
AGATGGGATTCGGAGCCGAGGGCGGCTGCGGCTGCAAGTGTGGACCAAAC
TGCAAGTGCGACCCTTGTAACTGTTAATGAAGACTACGAGACGTGAACAT
GCCCCAGAATAAAGCAGCGCTGTGAGGTCGTTTAAATTATAGTATCAATA
AAAAGAACTATTTATCGTTTGTGGTTGGCTTTGTTGGATGTCGTTTTATG
AGCTTTTGTTTGTAAAATAAAAACCAGCCATGGCTGCTTCTCCGAATCCT
TAACTGGGTCTGTTGCAGATCCATGGCTAGTTAATTAATCATTAAGTGTC
TCTGTGACTTTGTGTACGAGCGTATCTGTTACTGCTGCTATTCTAATGGG
AAGCTTCCTCTCAGACTTTTATCTATATTGTAAAATGTGTTTGGTTTATG
TACTGTATAATAAATTTACAACGTTGATTTCGGTTTGGAAAAAAAAAAAA
AAAAAAAAAA
back to top