EY756179

Overview
NameEY756179
Unique NameEY756179
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length182
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10454 contig Csv1_Contig10454:1219..1389. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-005-E10-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756179 ID=EY756179|Name=EY756179|organism=Citrus sinensis|type=EST|length=182bp
CCACGCGTCCGCTTTTTGTCGCGCAAGTTTAATTGTAATCAGCAGATTTG
GCTGAGTATTATTATGTCGTTGGTTGTAACGGCTAAATTTGTACGAGATT
GGAGGTGTAAATTTCCATTTCATTGTATTAATTAATCAACTTAAGTTGCT
ACTTTAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top