EY756175

Overview
NameEY756175
Unique NameEY756175
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length734
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1994 contig Csv1_Contig1994:304..1037. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-005-E06-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756175 ID=EY756175|Name=EY756175|organism=Citrus sinensis|type=EST|length=734bp
CCACGCGTCCGTCGCAATGGGGTTGCTGTTTTTCATGGGCGTCGAGTACA
CCCTCCGCATGGTCCCCGATTCTTCCCCGCCGTTCGATCTTGGGTTCATC
GCCACCCGGCCCTTGCATCGCCTCCTCTCTTCTTCGCCTCAGCTTAATAC
TCTGTTTGCAGCCCTCAATACGGCGTTTGTGGGGATGCAAACAGCTTACA
TACTGTGGACTTGGCTGATTGAAGGCCGGCCAAGAGCCACAATTTCGGCA
CTTTTCATGTTCACTTTCCGCGGAATTCTTGGTTACTCCACACAGCTTCC
GTTGCCTCAGGGATTTTTGGGTTCTGGCATGGATTTTCCGGTAGGGAACG
TATCGTTTTTCCTATTTTACTCAGGCCATGTTGCGGGGTCTGTGATCGCA
TCACTTGATATGCGGCGAATGCACCGGTGGGAAATGGCATGGCTTTTTGA
TGTGCTTAATGTTCTTCAAGCTGTAAGGTTGCTGGGCACAAGAGGTCACT
ATACAATAGATTTGGCTGTTGGTGTCGGTGCTGGAATTTTATTCGACTCT
CTTGCTGGAAAATACGAACAGAGCAAAAGCAAAATGGGAAGTGCTGCTAA
AGAATCTCTGTTAAAGTGAAACAAACGGGGCAATAAAAAATTTGGATGCT
TTAGGCTTACTCCTCTTTTTTTTTTTTTTAATTTTTGAAAGATACTTTAC
ATNCTTTAGNAAATTTTGTCTTGGTTTTGCAAAA
back to top