EY756170

Overview
NameEY756170
Unique NameEY756170
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length939
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-005-E01-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756170 ID=EY756170|Name=EY756170|organism=Citrus sinensis|type=EST|length=939bp
GGGGGNGNGGGGGGGGNNATTAAACCCCCCAATGGGGCNCTGTCACTTTN
ATATGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACGCGT
CCGCTGATTTCGATCTATTTGTCTGCAATCTTCTCATAGTTATATCACCA
AAGGAAAACGAAAAATGTCTGGCTGTGGTGGAAACTGTGGCTGTGGTTCT
AGCTGCAAGTGCGGCGGAGGCTGCGGCGGTAGCTCCATGTACCCTGACTT
GAGATCCTTTGAGAGCACCACCGTAGCCACCGAGACCCTCGTCCTCGGTG
TTGCTCCTGTCAAGATGCACTCTGAGGGGTCCGAGATGGGATTCGGAGCC
GAAGGCGGCTGCGGCTGCAAGTGTGGACCCAAACTTGCAATGCGACCCTT
GTACCTGTTAATGAAGAACTACGAGACGTGAACATTCCCCAAAATTAAGC
ACCCCTGTGAAGGCCGTTTAAATATAGAATCAAAAAAAAAACTATTTAAC
TTTTGGGGATGGCCTTTGTTGGAGGCGTTTTATAACCTTTTGTTTGAAAA
AAAAAAACCACCCTTGGTTGGTTCCCCCAAATCCTATAATGGGTCTGTTG
CAAACCCATGGGAAGCAAATTAAACCTTAAAGTGCCTCTGGAACTTTTGG
GAAAAAAAGAATCAGGAAACCGCTGCTTTTTCTAAGGGGAAAACCCCCCC
CACAGACCTTTCTTCTCAAAAAAAAAAAAAAAAAAAAAGGGGGGCCCCCT
CTAAAAGAACCCAAATTACTCAAAAGACCCGGAGGGGAAAAAAAAAAGAA
CCTCTTCTATTGGTGCACCCCAAAATTAATTTTACCGTTGCGCGCCTATT
ATATAACCCTCCCCCCCGGGGAAAAAAAAGCCTGGTTTCCCCCCACCTTA
TACCCTCGTTGCAACAGAACCCCCCCCTTGTGAACAGAG
back to top