EY756101

Overview
NameEY756101
Unique NameEY756101
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length577
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
EY756101_ssr486 microsatellite EY756101_ssr486:486..497.
Properties
Property NameValue
Genbank descriptionCS13-C1-001-003-F02-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756101 ID=EY756101|Name=EY756101|organism=Citrus sinensis|type=EST|length=577bp
CCACGCGTCCGGAGATCTTTCTGCCAACATGGAAACTACCTGTGCAGGTT
TACAGGCCAACTTCATTTCAGTTTATTTCATTTATAATTCTTATTTTAGT
ATATGCATTTATAAATATATTTTCTAATATGAATTTTTCAGGTAATAAGT
GGTCGGAGACTGTGAACGTCCAGCCGTGGCACAGTATTGCTGATGATGAT
ATGGTGAATGACAACCTTGATCTTCTTGTTGTCCCTCAATATGGGAGAAA
CCCCGACCGTATGGGTTAAGTGTAGTGCTATTTTTTAATGTTATGTTTAA
TTAAATAAATGATAGGTAACAATATACCTATCATTTATTTAATTAAACAT
AACATTAAAAAAATGATAGGTATATTGTTACCTATCAATCATGTTAGTAT
CTTAGTTTGGTTCAATTCAGCTTACAAGATCTCTTGATATGTAAAAGAGG
TTTTCTTTATTTACAAAATGATTTCCTTAAAAGGAAAATAAATAAATAAA
AGGTACTATGTGTGTCAACATATTGGTTATGTTAGTTTATACATATCGGT
TTAATACAAAAAAAAAAAAAAAAAAAA
back to top