EY756089

Overview
NameEY756089
Unique NameEY756089
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length944
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-003-E01-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756089 ID=EY756089|Name=EY756089|organism=Citrus sinensis|type=EST|length=944bp
TTCGTCGACCCACGCGTCCGGAGAAGCTGATATCCATTCGATTTGTATTC
TGCCGACTGAAAGAAGCAAAAAATCGGCGAATTTGAGATATTGGAGGTTT
GCGAAAGGAGATGGATCAAGGACTTGTTGAGAAGCGGTAATAATGGGAGC
ACTTGCAAAGATGGGGGATTATTAAGAGCTAGCTCAGAGATCAACACTAG
GCAAACGGCGTCGTCTGATTTCGTCTTACAGTGGGGGAACAGGAAGCGAC
TCCGGTGCATGAAAGTTCAAGTTCATAAAACGATTCGTCCGCTTCGGCCC
ATCGGACCACGGTTCTAGTCCTAAGACCCGACTAAGACACGTCCAATCGA
CCCAAGTACTGCCACCGCTTACCATTATATTGGGAACGGTTAATTTGAAT
GCTCCGTGCGAAGGGCAATTATTTAGAAATATCGGAAATGGGCACCCGAC
CCTTCAAGCGGGGAGTCCGCAATTCCTAAAGAATGCAAGGGGGCACTATA
TAATACCAGAAAAGAAACGTGGAGGTGGAAGAGGTTTGCTTTCCCAAAAA
AGGGGCGGGGGAACAGAATAAAAAGAGGAACCCCGGCCGAAACATTTAAG
AGCCTCACCGGACGGTATTTTTTGCACGTATAGGGGGGGAAACGGAGTGG
ACGACCATCTATTATATATTTAAAAAACGGGGGAGTCCCTTTCCCTCGTC
AGGGGGGAAAAAGACAAGAACACATACTATTGCGCGCCACCCCCACTGCG
AGGCGGGCGGTGCCTACCCCCCCCACCTAGTAGCGCCATGCGACAGGGGT
TCTCGTGGCGGAGATAGATTGTGATGTGGTCGCTGGTGGTAGAAAGAGTG
AACACATGACGGAGGGGAAGTATATAGCTACCATAGCACCACCCGCCCCC
ACCGCGTCCAACATTGATCATCGCGACATAAGCTCTTCTGATTG
back to top