EY756010

Overview
NameEY756010
Unique NameEY756010
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length182
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5880 contig Csv1_Contig5880:1746..1927. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-002-E12-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756010 ID=EY756010|Name=EY756010|organism=Citrus sinensis|type=EST|length=182bp
TCCGTCGACCCACGCGTCCGCTTCTTACTTTCTCTTGGTGAGAAGTATCT
GTATTTTCTAGTATTGATCAAAACTTTTTAGTAGTACTAGGTGATTGTGG
AAAGTAATCATGATGGAAGATAACAATGTTGAATATTAAATGCCATCAAT
GTTTGTAGATTAGCTGTAAAAAAAAAAAAAAA
back to top