EY756009

Overview
NameEY756009
Unique NameEY756009
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length515
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
EY756009_ssr328 microsatellite EY756009_ssr328:328..339.
Csv1_Contig2790 contig Csv1_Contig2790:174..688. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS13-C1-001-002-E10-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756009 ID=EY756009|Name=EY756009|organism=Citrus sinensis|type=EST|length=515bp
CCACGCGTCCGTGTAAATACTCCTGCAGCTGATAAGGCCACAGAGACACA
TGAAATTGAGGACGGCCGTGGAGGTTATAACCGCGGTGGCCGTGGAGGTT
ATAACGGCGGTGGCCGTGGTGGCTATGGAGGTGGTGGGGGCTATGGCGGT
GGTGGGGGCTATGGCGGTGGTGGGGGCCATGGCGGTGGCCACTGCCGCTA
CGGTTGCTGTGGACATGGTTATCATGGAGGCTGCAGGTGCTGCACTTACG
CTGGTGAGGCTGTTGATACGGAGCCTGAAACCGAGCCTCAAAACTGAAGC
TCCATAATAAATTTGTATCTGTATCTCAATAAATAAATAATCTTGCTTAC
ATTTATGCGATGTAAGCTTCATTCTGTTTTTCCTTTTTTCTTTGTTTTGT
AAGTGCAATGTAAGCTGCTTGTTCACAAAAAAAATACTTCTTTTATATAA
AAGAAGTATTTATGAATAAATGAGTACATTTTTAGAGCTTTCTCTAAAAG
AACCAAGCTTACATA
back to top