EY756008

Overview
NameEY756008
Unique NameEY756008
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length863
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-002-E09-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756008 ID=EY756008|Name=EY756008|organism=Citrus sinensis|type=EST|length=863bp
CCACGCGTCCGCGATACTTTCCTCATTGCTCAGAATTGGTTGATCGCTTT
TTGCATTGGCCCTATGCTTCCACCCCAGAAATGGACGAGGAGAAACTTAA
AGTATACGTGCAGGAGGCACTCCGCAAGGACGTGGCTTATCACCGTCGTT
CAGGGCTGCCATCATCCTGGTCGGCATTTTACAAGTACATGGCTGAGAGC
AATCAGTTGGCATTTTACAAGTACGTGGCTGAGAGCAATCGTTCAGGAAT
GCCGACGTCCTCGGCATCGAGCAATTAAGCATCACCTTTCCCTAAAAGTT
ATATTTGACACCTGGAAAACTAAAGGAGTTGAGTGAGCTCTGCTCGATTG
GTATTTGTAGTTTCTTTTTTTTTTTCCTCAAGTGATGTGGCATGTATCAA
TTAGTTTGTAAAGTTATTGGATTGTCTCAAGTCCGGTAAGATGCGCGAAC
GTATAGCATGGATCACAAACTCATTTCATAGAATATTTTTGTGTATAATT
ATATAATTTATAGGCCTTGCTTTNTCCATTATGGAACTGGAGCTATTTCT
GGTTTTTTTAGTGAAAACCATGTCAAAATCGGTGATCTTGTGGTCAAAGA
TCANGAATTTATAGAGGCGGCCGCTTAAAAGGACCCAACTTACTAACTGG
GGAATGCGACGGCATAACTCTTCTTGGGGGCCCCTAATTTCAATTCCTGA
CGCTCGGTTTAAACGTCACGAATGGGAAACCAGGNCGTTACCAAGAAAAA
GCGCTTGCAGCAAGTCCCCTTTAACGATGTGGGGAAAAAGAAAAGGCCCC
GCCTTTGCCCCTTCCAACCATGGCCCACCTAGATGGGAAAGGAACCCCCT
GGAACCGGAAATA
back to top