EY756005

Overview
NameEY756005
Unique NameEY756005
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length905
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-002-E06-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756005 ID=EY756005|Name=EY756005|organism=Citrus sinensis|type=EST|length=905bp
CCACGCGTCCGAACCGAACCAGATACCTCTTCGTTAGTTTACTACCTATC
CTATAGTATTAGAACTTCAATTGGCACTTGGTATCAGGATTTGTTTTGAT
ACTAAACTATGTGTAGCAATAATAATTGGTGCTTCGTGCATCCTCGTTGA
AGGATGTGATAAAAGTTATACTGAAGCAATAATACAGTGAAATTGAACGC
AAAAAAAAAAAATCATTGTATTGTGAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAACAAAAAAGGGAG
GAGGGGGGAAANANGGGGGNGGAAAAAAAAAAAAAGGGGGGGGGGCCCCC
AAAAAGGACAAAAGCCAAAAACCCGGGGGGGGAAAAAACAAAGCTTTCTC
AAGGGGGCCCCAAAAACAACCGCCGGGGGGCGATTTATAAACCCGGGGGG
GGGAAAAACCCCGGGGGACCCCCAATTTATCGTTTGGGGAACCAATCCCC
CTTTTCGAGGGGGGGGAAAAAAAAAGAGAGGCCCCACACAATCCCCTCCC
AAAATGTTGCCCCCCTATGGGAGAAATGGACCCCCCCCCTGCCGCCCCTT
AAAAGCGGGGGGGGGGGTGGGTTTTCCCCGGGGTGCACTCTTATTTGTGG
GGGCCCCTAAGGCCCCCTTTTTTGGGGTTTTCCTCCTTTTTGTCCACAAA
TGTGCGAGGGTTCCCACAGACAATTAGAAGGGGGGGCCCCCTATGGGGGC
CTATTTGGGGTTTGGGCCCCTCCCCCCCACAAAATTTGAGTGGGGGGGGG
GCCCCCTGGGGGGCCCCCCCCTATGAGAGGGTTTTCCCCTTTGGGGGGGG
AGCCC
back to top