EY756002

Overview
NameEY756002
Unique NameEY756002
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length452
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5240 contig Csv1_Contig5240:813..1264. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS13-C1-001-002-E02-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756002 ID=EY756002|Name=EY756002|organism=Citrus sinensis|type=EST|length=452bp
CCACGCGTCCGAATAGAGATTTTTCAAACTTTGCCCTGGATAGAATTCAA
TCAAACAATCTGCAATTTTAATTTATTGCTTTAGATGGAATTCACAATTT
GAATTTATTGCTTGTGATACGTTATTTGGAGATTTTGATGTGCAAGTTTT
GGTTACCGACGAAGGAGACACTAGTAGGTCACTTACTAACGTTGATTTAT
CTCCTACAAGTGTCACAGAGATGAATGCTACAAGAGATATAATTACAGCT
TTTATGTGGCATGATTACATAAGTAATGCATAATGTCTATTATGTAAGTT
TTTTATAATTATTTTATTTAAATCATGTGTTGTAATATATATCTTAATTA
TGGTGGAAAAATAATGACAATGTAAAAGTTTTTTTTAATTAATGCTAACT
CTAAAACTTTATTATCTCCTAGAGATTATTGTAATTGTTCAAAAAAAAAA
AA
back to top