EY756001

Overview
NameEY756001
Unique NameEY756001
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length374
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10954 contig Csv1_Contig10954:467..840. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-002-E01-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756001 ID=EY756001|Name=EY756001|organism=Citrus sinensis|type=EST|length=374bp
TCTCCTCGACCCACGCGTCCGAAGGAATGGACTTCCTCAAGGCCATCGAG
AAAGTGGGGTCCAGCTCCGGAAGGACCAACAAGCCCGTCGTGATCGCTGA
TTGCGGTCAATTGTCTTAGATTTGATCATGATAATGATCGCCATCATCAC
GAGCCGTCTGATCGCGATCGTGATGGTGATTATGTTATCTATTATTATGT
GGCCGTGTCTGTAGGACTTTTAATCTTTATCTAATTTTCCTGCTATGTTA
CTTGTTCGGGTTGGATCGGGTCTCCGGTGGTGGTTCTTGATGAACTGTTT
TTTATGTCTTTCTATGAGCTGCCTTTTTAAATAAGATAGGGCTTGTCTTG
TTAAAAAAAAAAAAAAAAAAAAAA
back to top