EY756000

Overview
NameEY756000
Unique NameEY756000
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length212
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig242 contig Csv1_Contig242:722..933. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-002-D12-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756000 ID=EY756000|Name=EY756000|organism=Citrus sinensis|type=EST|length=212bp
CCACGCGTCCGAAATAGCATAGCTGGGTCTACTGTCTAGTTTATTATTTT
CCATTTCGTACCTTTTCTCAGTTGAACTGGATTTCTCAAGTTGAAGTGAC
ATGTTTCTTTGGTTTAACTATGTGATCCTTGCAGTTGTTTTAGTGATTTG
CAATTTGCACTCTTCTATATGATTTATATGGTTTATTTAAAAAAAAAAAA
AAAAAAAAAAAA
back to top