EY755998

Overview
NameEY755998
Unique NameEY755998
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length888
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13296 contig Csv1_Contig13296:1..889. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-002-D10-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755998 ID=EY755998|Name=EY755998|organism=Citrus sinensis|type=EST|length=888bp
CCACGCGTCCGCTCTAATGTTTTCGCAATGGAGAAAATCCTATAGCTTGA
CTGTATTCTTGTTAAAGACGGATACCAGGTTTGAGGATCATGGTTATGAG
TGTATGAATTAAGAGAGATGAAAGCAAAGAACTCTGGGCCTTTGTTCCTA
CTTCCTTCTAGAGCTGAAAAATAGGCTACTTGCTTTTTATTTTCCGAATT
GGAGTTATTGATGACAATTACCTTTTGCATAGTGACCCTCGAAAGCAGGG
GGTGAGAAGGGAAGTAGGAGTTCATGCAAAAGCACTAAACAGGCACCTAG
CTAAGGCACAAGTTAACTCAACGGTCTCCAAGGACAGAGATAATTTGATT
GATGGCCAAGAAGGAGCACCATCCACATCAAATATGGAGTGCTTAGGTTC
TCTGTTGGCTAATGAAACAAAATCTTATGCATCAAACTCAACAAATGCTT
CCCCTCTATTATTAAGATCCAGTAAGAAGACAAGGCAAACTGAAGAGATG
GTATTGCCTTTTGGATTAGCAGATGACGTCCAAGAAGGATCAGAAAAAAA
GGTGGATAATTCGATTATGTTCAAAGAATCAATTGGACACACTGAGGTTG
AAGTCGTAGCTGGTGCTTTATTAGGATTCCTTGTTAGCCTGGCTGTGTCT
GCAATAATGTGAGATCATGCAATTAATTTTTATATTTAGATTTTCTGTTC
ACTATTGCTGTATGTTAATATATATCTAGGTATTCAATGTGGTTCACTTT
TGTAGTTCAGTATGACTTGACTGCATATGTCCCATTTTTGTCAGGGTATA
CGTCAAAATAGCCATATTTCACTTGCAATCACTTGNTTATCATTTTGGAA
TCTATAGGAAGTTATCATTTAAAAAAAAAAAAAAAAAA
back to top