EY755997

Overview
NameEY755997
Unique NameEY755997
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length156
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1265 contig Csv1_Contig1265:68..223. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-002-D08-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755997 ID=EY755997|Name=EY755997|organism=Citrus sinensis|type=EST|length=156bp
CCACGCGTCCGGAATCAAGTCTATCAAGATTTGTGGTACTTCTGAGGGTT
GGTCATGTGTATTATGCAAAACGCATCGGAAAATAATTTATTTCAGTTTC
TCATCGGATAAAATGTTTCAATTTTGAAAAAAAAAAAAAAAAAAAAAAAA
AAGGGC
back to top