EY755992

Overview
NameEY755992
Unique NameEY755992
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length343
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1751 contig Csv1_Contig1751:745..1087. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-002-D03-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755992 ID=EY755992|Name=EY755992|organism=Citrus sinensis|type=EST|length=343bp
CCACGCGTCCGGAGAAGTGGCTGGCCTATTTGAATGTTACGTGCCCGCTT
TGCAGGACACCTCTAATTCCTGAGTTTGAAGACCATCCCTCTTGCTTCTG
GTGAGAGTGTTTTATGAGTTTGTCTGGTTGAGGAGACTTCTATGTACAGC
ATGTAGTGTACAGGTATTTACTAATGCATCGGCTGGAGTGTAGTGTTTAT
TACACGCCTTCTATGTGTGAGTTCAATCTCGAGTCCTTTTGAAGGCTTGT
TGAGAAAACCAAAATTCTGTTGTAAATATTGTGAGGTTTCTGGTTGTTTT
ATGGCNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top