EY755986

Overview
NameEY755986
Unique NameEY755986
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length892
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY755986_ssr267 microsatellite EY755986_ssr267:267..278. BLAST: Citrus ESTs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-002-C08-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755986 ID=EY755986|Name=EY755986|organism=Citrus sinensis|type=EST|length=892bp
CCACGCGTCCGAACTTCTACTCCCAAGTTGCGATTGCCAGTTCAATTTGC
TTATTCCTCTGGCTCTGCTTCTGGCCTCCTCGAGAGAATCTAAATCTACA
AGAAACTCACAAGATAAGACTCCCAATTCTTCCCCAAAAATGAACGGCAT
AGAGAGGAGGACGAGAGTGTGGCAGAATCTAAAGCAACGGCTGCGATTGA
AGGGAATGGGGTGTTGTGGATCCATGTGGAGCTTCAGAACTCAAACACTC
ACAATCATGCCGCGACAAGAAGAAGAAGAACAAGAAGAACCAGAAGAACA
AGAACGGGGAACCCACGTCCGCATGCACATGCGAAACGCTGCCGCATCAG
TTACTGCTGCTGGTGCCGGTACTACCATTAACATGAACCTGGCCATGGCA
CTAGCTGCCGAGCGCAATTTGCGCTCTGGAGACGGCCTCGTGGTTCCCAA
AAAGAATGCTGCTGGAACCGCTGTCAAGACGCTGATGATGCTGATTGAAG
AAACGGACGGTGGTGATTGGCAGATGAAAAAAGATGGCGACGTGGAAGGA
GGAGAAGTACTGACACTGAGGGAGGGCAGCGATTGGATGTGCTGCGTCTG
CATGGAGAGGAATAAAGGTGCGGCTTTTATTCCCTGCGGCCACACTTTTT
GCAGAGTTTGTTCAAGGGATCTGTGGCTCAATCGCGGGACTTGTCCTATT
TGCACCGTTCGATTATTGAAATCCTTGATATTTTTAGAACCTTTTCCTTT
CAATAGATGGTCGTACAACTTGCAACTGAGAGAGATCAAATTCAAATCAT
ATTCATATAATAGACTATGCTGATTACATTTGGATTATCCAAAAAAAAAA
AAAAAAAAAAAAAAAGGGCGGCCGTTCTAAGGATCCAGTTTA
back to top