EY755981

Overview
NameEY755981
Unique NameEY755981
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length411
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12881 contig Csv1_Contig12881:1220..1630. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-002-C03-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755981 ID=EY755981|Name=EY755981|organism=Citrus sinensis|type=EST|length=411bp
TCCGTCGACCCACGCGTCCGCTCGAAGCTAGCACAGATCTTTTCTGACTT
GAAGAATATGAAAACTCTTCCTGGCGCAGGTATGAGCGATCCGTCAGAAG
GTTACTTACTCCCCCCTTCCAGTATTGCTGATGATGATGTTGGGAATGAC
AATCTTGATCTTATTGTTATTCCTCAATATGGGAGAAATCCTGATTATTA
TGGGTAAGTGTCTACAATCTGGATGATGATATATATAATTAAATAAAAAG
ATGGGTACAGTTATTACCTATCAATTATAAGAGTGTCAATTTAGTTCAGT
TCACTTACAAAAATCTCTTATACAAGAGATTATCTTTGTTTGCGTTCATG
TACTTTGTCTTCTTTAATTAATAAATAAAACTATTGTGTATCATTGTGTT
GATTAANNNNN
back to top